Dharmafect sirna
WebWe have the most complete collection of transfection reagents with exceptional performance for the delivery of DNA, siRNA, Invitrogen Stealth RNAi and Invitrogen BLOCK-iT RNAi Vectors, in traditional or difficult-to-transfect cell lines. Remember to refer to the Seven Steps to RNAi Success when planning RNAi Experiments. WebMaterials required for use of RTF siRNA Libraries. 96-well RTF siRNA Library plates, containing 6.25 pmol of SMARTpool siRNA reagent per well (triplicate experiment recommended) DharmaFECT transfection reagent, or other optimized transfection reagent (sold separately) Serum-free and antibiotic-free cell culture medium such as MEM-RS,
Dharmafect sirna
Did you know?
WebBe the first to review this product. Efficient siRNA or microRNA transfection. To attain efficient and reliable siRNA or microRNA transfection, we offer DharmaFECT … WebCell line Cell type Recommended DharmaFECT formulation DharmaFECT volume/well (µL)Plating density Other successful formulations Rodent A7R5 Rat aortic smooth muscle 2 0.1 5 x 103 1 C2C12 Mouse ...
WebScrambled siRNA (si-SCR) was obtained from Dharmacon (cat. no., #D-001210-01; GE Healthcare, Chicago, IL, USA). For transfection, 10 nM siRNA was mixed with DharmaFECT ® 1 transfection reagent (Dharmacon; GE Healthcare) and used according to the manufacturer's protocol. WebFunctional Co-transfection of Plasmid DNA and siRNA Using the TransIT-X2® Dynamic Delivery System. TransIT-X2® Dynamic Delivery System was used to transfect plasmid Cy®5 labeled DNA encoding nuclear YFP and Cy®3 labeled siRNA into HeLa cells.Transfection was performed in 6-well plates with Poly-L-Lysine (PLL) coated …
WebFeatures: Exceptional siRNA transfection efficiency Great for siRNA/DNA co-transfection Broad cell spectrum Low cell cytotoxicity siTran 2.0 Products siTran 2.0 Transfection Data siTran 2.0 was used to co-transfect TYE-563 labeled siRNA (CAT# SR30002) and GFP plasmid DNA (CAT# PS100093 ). Images were taken 48 hrs post transfection. WebThe functional inactivation of TP53 and Rb tumor suppressor proteins by the HPV-derived E6 and E7 oncoproteins is likely an important step in cervical carcinogenesis. We have previously shown siRNA technology to selectively silence both E6/E7 oncogenes and demonstrated that the synthetic siRNAs could specifically block its expression in HPV …
Web• siRNA (and microRNA mimic) should be resuspended in RNase-free solutions. We recommend 1x siRNA Buffer (diluted from Dharmacon 5x siRNA Buffer, Cat #B-002000-UB-100). For short-term storage, RNase-free water (Cat # B-003000-WB-100) is also appropriate for resuspension of ... For protocols using DharmaFECT ...
WebDharmaFECT 1 is the most all-purpose transfection reagent, demonstrating efficient, low-toxicity delivery to over 80% of validated cell types. DharmaFECT 2, 3, and 4 offer … can i write off a cash gift to my childWebDharmaFECT® Duo is a lipid-based reagent specially formulated for co-transfection of plasmid and siRNA. Under optimized conditions, efficient delivery of both plasmid and siRNA can be achieved with minimal cell toxicity. As is generally observed with plasmid transfection, cell viability is reduced compared to siRNA transfection alone. five types of argument claimsWebSep 28, 2012 · This is vastly superior to a commercially available control, DharmaFECT, which resulted in only ∼60% siRNA positive MSCs. Moreover, the diblock copolymer, at conditions that result in excellent knockdown (down to ∼10% of control gene expression), was cytocompatible, causing no negative effects on MSC survivability. five types of analyticsWebDharmaFECT 1 is our most all-purpose transfection reagent formulation; demonstrating efficient, low-toxicity delivery to over 35 cell types. DharmaFECT 1 achieves effective … can i write off 401k lossesWebLung cancer cells were transfected with USP14 siRNA (siUSP14#1 and siUSP14#2) or nonspecific siRNA (siNC) (all from Shanghai GenePharma Co., Ltd, China) using DharmaFECT one siRNA infection reagent (Thermo Fisher Scientific). The siRNA sequences were: siUSP14#1: GACAGAAAGUUAUGGUGAAAG; siUSP14#2: … can i write off an investment losscan i write off a gift of moneyWebamount of siRNA at 20 nM/well but varied the amount of transfection reagents by ±25% of the dose recommended by the manufacturers. For example, Dharmacon recommended 0.8 µl/well DharmaFECT 3 transfection reagent for macro-phages seeded in a 12-well plate. Therefore, 20 nM Bax siRNA was transfected with 0.6 µl, 0.8 µl, or 1.0 µl/well … five types of air masses